ZiFiT Targeter Version 4.2
Please indicate with brackets the nucleotide at which you would like the double-stranded DNA break (DSB) to occur
For example:
>Sample 1
AGCTACGATCGACTACGATAGTCGGCTACGGACTGAC[T]GACTGACTAGCTACGATCGACT
>Sample 2
CTACGATAGTCGGCTACGGACTGAC[T]GACTGACTAGCTACGATCGACT