ZiFiT Targeter Version 4.2


Examples :

 

TALE Nuclease assembly

Assembly using FLASH

Assembly using REAL or REAL-Fast

TALE Effector assembly

Assembly using FLASH

Assembly using REAL or REAL-Fast

Example: TALE Array Assembly using FLASH

1) Select ZiFiT from the menu bar and follow the link labeled “Design TALEffectors using FLASH assembly” under Monomer Array Assembly


2) Paste the following sequence into the box labeled “Sequence” at the top of the input page. Click the Submit button.

>Sample Sequence

>Sample1
AGCTACGATCGACTACGATAGTCGGCTACGGACTGACTGACTGACGACTACGATAGTCGGCTACGATCGACT
>Sample2
AGCTACGATCGGACTACGATAGTCGCTACGATAGTCGTACGATAGTGACTACGATAGTCGCTACGGACTGACTGACTGGAGACTACGATAGTCGCGATAGTCGACGATCGACT

3) Enter the length of choice (We recommend using length 16-18) Click the Submit button.


4) Output: For each sequence in the query list one target site is identified and the results are presented in the form of a table. Each row in the table contains information about each target site. In addition to the target site the following information is provided:

i. Sequence Name

ii. Target site

iii. FLASH-IDs: List of FLASH plasmids required to build the TALE

 

The information from the output table can be exported to a comma separated value (CSV) file by clicking on the "Save to CSV" button. The CSV file will contain the expected DNA sequence of the TALE being designed.

 

Example: TALE Array Assembly using REAL or REAL-Fast

1) Select ZiFiT from the menu bar and follow the link labeled “Design TALEffectors using REAL or REAL-Fast assembly” under Monomer Array Assembly


2) Paste the following sequence into the box labeled “Sequence” at the top of the input page. Click the Submit button.

>Sample Sequence

>Sample1
AGCTACGATCGACTACGATAGTCGGCTACGGACTGACTGACTGACGACTACGATAGTCGGCTACGATCGACT

3) Enter the length of choice (We recommend using length 16-18) Click the Submit button.


4) Output: All target sites that meet the length criteria will displayed. Note:

i. All sites on the +ve starnd are listed first

ii. All sites on the -ve strand are listed second

iii. All sites are aligned to the sequence sequence

iv. Click on any target site to download a graphical guide for building the TALE using REAL or REAL-Fast.

 

Clicking on any of the target sites will open a new window with a printable graphical guide for assembly

 

Example: TALEN Assembly using FLASH

1) Select ZiFiT from the menu bar and follow the link labeled “Design TALE Nucleases (FLASH)” under Nuclease Assembly


2) Paste the following sequence into the box labeled “Sequence” at the top of the input page. Optional: You can indicate around which NT you would like the Double Stranded Break (DSB) to occur using brackets [] Click the Submit button.

>Sample Sequence

>Sample1
AGCTACGATCGACTACGATAGTCGGCTACGGACTGAC[T]GACTGACGACTACGATAGTCGGCTACGATCGACT
>Sample2
AGCTACGATCGGACTACGATAGTCGCTACGATAGTCGTACGATAGTGACTACGATAGTCGCTACGGACTGAC[T]GACTGGAGACTACGATAGTCGCGATAGTCGACGATCGACT
>Sample3
AGCTACGATGACTACGATAGTCGACTACGATAGTCGGCTACGGACTGACTGACTGAGACTACGATAGTCGACTACGATAGTCGATCGACT
>Sample4
AGCTACGATCGGACTACGGACTACGATAGTCGTAGTCGACGATAGTCGGCTACGGACTGAC[T]GACTGACTAGCTACGGACTACGATAGTCGCGACT


3) Output: For each sequence in the query list one target site is identified and the results are presented in the form of a table. Each row in the table contains information about each target site. In addition to the target site the following information is provided:

i. Sequence Name

ii. Left Binding site (5' - 3' on +ve strand)

iii. Spacer

iv. Right Binding site (5' - 3' on +ve strand)

v. Actual Right Binding Site

vi. FLASH-IDs (Left): List of FLASH plasmids required to build the TALEN

vii. FLASH-IDs (Right): List of FLASH plasmids required to build the TALEN

 

The information from the output table can be exported to a comma separated value (CSV) file by clicking on the "Save to CSV" button. The CSV file will contain the expected DNA sequence of the TALEN being designed.

 

Example: TALEN Assembly using REAL or REAL-Fast

1) Select ZiFiT from the menu bar and follow the link labeled “Design TALE Nucleases (REAL and REAL-Fast)” under TALE Repeat Array Assembly


2) Paste the following sequence into the box labeled “Sequence” at the top of the input page. Please indicate around which NT you would like the Double Stranded Break (DSB) to occur using brackets []Click the Submit button.

>Sample Sequence

AGCTACGATCGACTACGATAGTCGGCTACGGACTGAC[T]GACTGACTAGCTACGATCGACT


3) Output: Top 5 TALE nuclease target sites are listed. The following criteria are used to pick the Top 5 sites:

i. Sequence is trunctated to include only 50 bp flanking either side of the bracketed nucleotide

ii. Tier 1 sites: Sites where the length of the TALE binding site is 18 bp (including the 5' T) and the spacer region is 16-18 bp are identified in which the position of intended mutation (i.e. the bracketed nucleotide) lies within the spacer region

iii. Tier 2 sites: If < 5 sites are found, the search is performed again and sites where the length of the TALE binding site is 16-18 bp (including the 5' T) and the spacer region is 13-23 bp are identified in which the position of intended mutation lies within the spacer region

 

If you do not find any sites you can uncheck the "Mask redundant sites" option. This option is unavailable if you are using ZiFiT in batch mode

 

If the query sequence is short or has very few T's users still might not find enough sites. If this is the case check the "Relax Constraints" option. ZiFiT Targeter will then report all potentially targetable sites where the length of the TALE binding site is 13-22 bp (including the 5' T) and the spacer region is 13-23 bp are found such that the position of intended mutation lies within the spacer region

 

Note: All sites are sorted first based on total length of the TAL binding site, followed by proximity of spacer length to length 16

4) Retrieving graphical guides for TALEN plasmid assembly summary: Clicking on the a TALEN binding site in the output will display an image (see example below) summarizing the steps required to construct the plasmid encoding that TALEN. All Plasmid numbers (“TAL Unit #”) in the display correspond to the names of plasmids available from Addgene.



Users can switch between the REAL and REAL-Fast assembly methods using the 2 buttons on the top of the page.

5) To help users sequence verify their TALEN construct, the DNA sequence of the construct is provided below the assembly graphic.