ZiFiT Targeter Version 4.2


Examples :

 

CRISPR/Cas Assembly

Assembly using T7 promoter

Example: CRISPR/Cas assembly for T7 based system

1) Select ZiFiT from the menu bar and follow the link labeled “CRISPR/Cas” under Design Genome Editing Nucleases


2) Paste the following sequences into the input box. Click the Identify target sites button.

>Sample Sequence

>Sample1
aaaaaaataatgaagcccaaactgaagattctgtgagcgtccctcacaggtgttttctctcggtgtgtgtgtgttcagGAGCGTTCCTGGTGCCGTATCTCTTCTTCATG[T]TGATCGCCGGGATGCCGCTCTTCTACATGGAGCTGGCGCTGGGTCAGTATAACCGTGAAGGAGCCGCCGGCGTCTGGAAGATCTGCCCCATATTCAAAG
>Sample2
gagctagaacaagactagtatagtgtgcacacacactaacttgcattctaaaactcttgtgtttgtgctgtattgcagGCTACAATACTCCCACTGAAATGACAGA[T]GCAGACAGACTCATGGACAGTTGGTATCTGAAGTCACTCGGTGGCTTTATTACAGTGGTAACATCAGATGGAGACATGATCTTCTT
>Sample3
ccaccaattgtgtccccgtgaaagcagcagaagagcgtgtagtgtttcagtgataagcgtccgccccccgattctcgcCTCTGGTTGGAGAGCAGTAGTTCCGCCCCCGGTCGCCATGTACCGCTCCGCTCGCTCCCTGCATCGCTTCAGCGCG

3) Users can change the 5' GG requirement imposed by the T7 promoter, but if you choose to do so, you won't be able to clone into pDR274 anymore.
Click the Identify target sites button.


4) Output: For each sequence in the query list, one target site is identified and the results are presented in the form of a table.
Sites are chosen using the following criteria:
1. Proximity to desired position of the double stranded break (the bracketed nucleotide [nt])
2. If no nt is bracketed, the target site is centered within the query sequence
3. If ZiFiT Targeter is unable to identify any target sites the, 5' GG constraint is ignored and the search is performed again.

Each row in the table contains information about each target site. In addition to the target site the following information is provided:

i. Sequence Name

ii. Target site

iii. Sequences of two oligonucleotides required to construct a gRNA expression vector (i.e.—to be cloned into pDR274)

 

The information from the output table can be exported to a comma separated value (CSV) file by clicking on the "Save to CSV" button. The CSV file will contain the oligo information.