ZiFiT Targeter Version 4.2
Please enter query sequences in FASTA format and (Optional: indicate with brackets the nucleotide at which you would like the double-stranded DNA break (DSB) to occur)

For example:

>Sample1
aaaaaaataatgaagcccaaactgaagattctgtgagcgtccctcacaggtgttttctctcggtgtgtgtgtgttcagGAGCGTTCCTGGTGCCGTATCTCTTCTTCATG[T]TGATCGCCGGGATGCCGCTCTTCTACATGGAGCTGGCGCTGGGTCAGTATAACCGTGAAGGAGCCGCCGGCGTCTGGAAGATCTGCCCCATATTCAAAG

Please ensure that your query sequence do not contain repeat elements. We suggest that you check the sequence using RepeatMasker
Length of target site